Protocol Tag: Animal Models

Preparation of NTBC drug solution (1000X).

1. Dissolve 8 g of NTBC in 1 liter of 0.5% sodium bicarbonate at 65°C for 30 min. Shake every 3-5 min until the entire compound dissolved (see Note 1).
2. Filter the solution with a 0.22 um filter. Aliquot and store at -20°C.
3. NRG/F mouse genotyping and colony maintenance.
4. Mouse genomic DNA extraction.
5. Genomic DNA is extracted from mouse-tail tips using the KAPA Mouse genotyping Kit according to the instructions. (See Note 2).
6. For one sample, mix the 10X KAPA Express Extract Buffer (5 μl /sample), 1 U/μl KAPA Express Extract Enzyme (1 μl /sample) and ddH2O (44 μl /sample). The volume can be scaled up accordingly for more samples.
7. Heat at 75 °C for 15 min, and inactivate the enzyme at 95 °C 5 min (see Note 2).
8. The sample can be stored at 4 °C for 1 week, or frozen at -20°C for long term.

 

Quantitative PCR detection of FAH^-/-

1. Genomic DNA extract is diluted at a ratio of 1:20 (5 μl to 95 μl ddH2O) and use 5 μl as template.
2. For the FAH^-/- detection, use the following primers, FAH-QF (TTGAATCTTGAAGAATGGTTTGAGC), FAH-QR (AATGCCAACATGATCATCCTAGG), with amplicon size 148 bp. Mix both primers for a final concentration of 10 μM.
3. For the mouse genome DNA control, use the following primers, mGAPDH (450+26) (AACCACGAGAAATATGACAACTCACT) and mGAPDH (584-20) (GGCATGGACTGTGGTCTAGA), amplicon size 134 bp. Mix both primers for final concentration of 10 μM.
4. Set up of qPCR reaction: 2 X SYBR buffer 7.5 μl, primers mix (10 μm) 0.105 μl, ddH2O 2.4μl, and diluted sample 5μl.
5. Program for qPCR: step 1, 50°C 2 min; step 2, 95°C 15 min; step 3, 95°C 15 sec; Step 4, 60 °C 1 min; go to step 3 for 35 cycles.
6. Data analysis: normalize the FAH^-/- to mGAPDH. No FAH^-/- signal should be detected in negative controls. Set heterozygous mice to 1 and the homozygous mice should be around 2.
7. NRG/F homozygous mice maintenance.

NRG/F homozygous mice must be maintained with 100% NTBC (8 μg/ml).  The NTBC drug is pretty stable up to 3 weeks in the cage.

Transplantation with human adult hepatocytes.

1. Hepatocyte preparation.
2. Suspensions of freshly isolated or cryopreserved primary human hepatocytes (PHH) could be used for liver humanization. Our PHH are usually obtained from the Research Triangle following the instructions of the supplier.
3. Centrifuge cells at 100 g for 10 min.
4. Carefully discard most of supernatant, keeping less than 0.5ml residual medium.
5. Resuspend and count the cells, and determine the cell viability with Trypan blue usually around 80%.
6. Adjust the volume with medium to 1×10⁶ cells/50 μl per mouse.
7. Intrasplenic injection.

Throughout the procedure, standard sterile surgical techniques are used, including 70% ethanol sterilization of instruments between animals.  The entire surgical procedure must be performed under biosafety cabinet with a laminar flow and should not exceed 10 minutes per mouse because the viability of PHH could decrease during the procedure.  If splenic bleeding occurs, use sterile swab to exert slight pressure on the spleen and close only if the bleeding stops. After surgery, mice must be kept in a warm environment such as post-surgery warming pads to facilitate a better recovery. Mice should wake up in about 2 hours.

1. Mouse anesthesia is performed with intraperitoneal injection of 500 μl of Avetin. Depending on the weight of the mouse. It will take about 2 min to fully anesthetize the mouse. Checked toe pinch reflex before surgery.
2. Shave the left side abdomen around the spleen.
3. Lay the mouse down on surgical board and sterilize the shaved region by sequentially using Povidone-Iodine and 70% ethanol on the body surface with swab.
4. Open the skin and the muscle of abdomen with scissors. The incision size is about 1 cm.
5. Gently pull out the fat pad under the spleen using a curved blunt-ended forceps.
6. Slowly inject 1×10⁶ PHH in 50 μl into the lower pole of the spleen.
7. After injection, pull out the needle very slowly to prevent bleeding (see Note3).
8. Close abdominal muscle layer with muscle suture.
9. Close skin layer with skin staples.
10. Wound clips should be removed within 10 days after surgery.

NTBC cycling.

The timing of NTBC cycling is very important, since NTBC controls the level of liver damage (see Note 4). The cycle is listed below and summarized in table 1. The remaining NTBC water can be reused at each step for further dilution.

Cycle 1:

• Day 0, right after surgery, change water to 25% of NTBC (2 μg/ml).
• Day 2, change water bottle to 12% NTBC (0.96μg/ml).
• Day 4, change water bottle to 6% NTBC (0.48μg/ml).
• Day 7, change water to 0 % NTBC.
• Day 21, Change the water to 100% NTBC.

Cycle 2:

• Day 28, change water to 25% of NTBC (2μg/ml)
• Day 30, change water bottle to 12% NTBC (0.96μg/ml).
• Day 32, change water bottle to 6% NTBC (0.48μg/ml).
• Day 35, change water to 0 % NTBC.
• Day 49, Change the water to 100% NTBC.

Cycle 3:

• Day 56, change water to 25% of NTBC (2μg/ml)
• Day 58, change water bottle to 12% NTBC (0.96μg/ml).
• Day 60, change water bottle to 6% NTBC (0.48μg/ml).
• Day 63, change water to 0 % NTBC.
• Day 77, change water to 100% of NTBC (2μg/ml)

Cycle 4:

• Day 84, change water to 25% of NTBC (2μg/ml)
• Day 86, change water bottle to 12% NTBC (0.96μg/ml).
• Day 88, change water bottle to 6% NTBC (0.48μg/ml).
• Day 91, change water to 0 % NTBC.

 

Table 1: Schedule of NTBC drug recycling (see Note 4).

Cycle	NTBC concentration
	25%	12%	6%	0%	100%
1	Day0	Day2	Day4	Day7-21	Day21-28
2	Day28	Day30	Day32	Day35-49	Day21-28
3	Day56	Day58	Day60	Day63-77	Day77-84
4	Day84	Day86	Day88	Day91-

 

Generation of NRG/FAH-hu HEP mice with 4 cycles of NTCP reduction

Human Albumin quantitation

Adapted from a protocol of Bethyl Laboratory human Albumin ELISA Quantitative Set (see Note 5).

1. Plate coating: Coating antibody dilution 1:250 (see Note 5). Add 100 µl of diluted coating antibody to each well. Note: Run each standard or sample in duplicate.   Incubate overnight at 4°C.  Wash plate 5 times.
2. Add 250 µl of Blocking Solution to each well. Incubate at room temperature for 30 minutes.  Wash plate 5 times.
3. Dilute the plasma/serum samples during step 1 and step 2. Fold dilution, 100 during week 3-7, and 1000 thereafter. Standard dilution: to 400, 200, 100, 50, 25, 12.5, 6.25, 3.125 ng/ml.
4. Add 100 µl of standard or sample per well. Incubate at room temperature for 1 to 2 hours. Wash plate 5 times.
5. Prepare 1:30000 dilution of detection antibody dilution (see Note 5). Add 100 µl of diluted HRP detection antibody to each well. Incubate at room temperature for 1 hour. Wash plate 5 times.
6. Add 100 µl of TMB Substrate Solution to each well. Develop the plate in the dark at room temperature for 15 minutes. Stop reaction by adding 50 µl of Stop Solution to each well. Measure absorbance with a plate reader at 450 nm.

 

HBV infection and detection.

1. Inoculate NRG/F-hu HEP mice with HBV

For infection studies, NRG/F HuHep mice with hAlb. > 0.5 mg/ml are subjected to a short anesthesia, Isoflurane, then inoculated through retro-orbital route with 1×10⁷ ge of HBV derived from patient or in vitro.

1. Detection of HBV DNA in mouse serum/plasma (See Note 6)

Serum or plasma was obtained from tail vein or retro-orbital bleed and HBV viral DNA was extracted with QIAamp® MinElute® Virus spin Kit according to the instruction. Elute HBV DNA with 50 µl elution buffer.

• The following primers are used to quantitate HBV viral load. Forward primer: GTTGCCCGTTTGTCCTCTAATTC; Reverse primer: GGAGGGATACATAGAGGTTCCTTGA
• Setup of the q-PCR reaction: 2 X SYBR Green ROX buffer 7.5μl; mixed primers (10 μM) 0.25 μl; ddH2O 2 μl; standards and sample 5μl. Prepare duplicate wells for each sample.
• HBV standard is performed with HBV 1.3 mer plasmid with dilution from 10⁸ to 10¹ copies/reaction.
• Program for q-PCR. Step 1: 50°C 2 min, Step 2: 95°C 15 min, Step 3: 95°C 15 sec, Step 4: 60 °C 1 min, go to step3 for 40 cycles.

 

Notes

 

1. The NTBC can be dissolved in 100% DMSO, in which case it does not need to be heated. If dissolved with DMSO, special filters resistant to DMSO should be used.
2. Foot, finger, and ear tissue can also be used. The KAPA express extract takes much less time. Other methods to extract genomic DNA using Protease K digestion can also be used to extract genomic DNA. Unlike digestions with Proteinase K, KAPA Express Extract does not completely degrade the tissue. There will be intact tissue visible in the tube after lysis. This does not have a negative impact on the downstream PCR.
3. Ligation is required sometimes, but it is not necessary if a small volume of cells is injected and the needle is pulled out very slowly. We only use 1 million cells in the NRG/F mice. Up to 5 million cells have been used in published reports [20]. Our experience is that large volume (100 μl) injection with a high concentration of cells usually causes bleeding.
4. If the surgery is not successful, mice will soon die (day 2 to day 10). At around day 21 in the first cycle and day 49 in the second cycle, the NTBC must be put back to 100%. Otherwise, the majority of the transplanted mice will be lost. We have observed a big loss of mice at week 3 and week 7 after surgery if NTBC is not adjusted back to 100%. The time of cycling also relies on the amount and proliferation capacity of human hepatocytes injected. If more cells (> 1million cells) are used, the interval of NTBC 0 % can be extended. If the transfected adult hepatocytes are highly proliferative, the interval of NTBC 0% can be extended. However, this requires consistent checking of the mouse health status.
5. Coating antibody is used at 1:100 dilution in the original manufacturer’s protocol. However, 1:100 dilution usually gives a high background. Use of the coating antibody at 1:250 dilution will not only reduce the background but also greatly reduce the cost.
6. We usually use quantitative PCR to detect the HBV viral DNA. HBsAg ELISA can be used to detect HBsAg.

Acknowledgements

We thank current and former Su lab members for assistance and discussion. This work was supported in part by a grant from NIH: AI138797 (L.S.).

HBV plasmid preparation

1. HBV plasmid preparation can start with a competent cell transformation or a glycerol stock (Note 3). Proceed to Step 3, if a glycerol stock is used.

Note 3: A glycerol stock is made from LB culture medium. Add 500 μL of the overnight culture to 500μL of 50% glycerol in a 2 mL screw top tube and gently mix. Store in -80 ^oC. The 50% glycerol medium is made by diluting 100% glycerol in water. Sterilize the glycerol medium before use.

 

2. Transform ECOS^TM 101 Competent Cells with 5 uL HBV plasmid according to manufacturer’s procedure (Note 4). Incubate LB plate at 37 °C overnight.

Note 4: Take one tube of ECOSTM 101 Competent cells out of -80 ^oC and thaw on ice (~ 20 minutes). Add 5μl of HBV plasmid into competent cells. Vortex for 1 second or flick the bottom of the tube with finger a few times. Place the mixture on ice for 5 minutes. Heat shock the transformation tube by placing the bottom 1/2 of the tube into 42 ^oC for 45 seconds. Take 100 uL of the competent cell/DNA mixture and plate the LB plate.

 

3. Inoculate the tube containing 5ml LB with a single colony using a pipette tip or with a bacterial stock (Note 5). Incubate with 250 rpm shaking overnight at 37 °C. The tube should be very cloudy as a result of bacteria.

Note 5: To recover bacteria from glycerol stock, open the glycerol stock tube and use a pipette tip to scrape some of the frozen bacteria off of the top. Do not let the glycerol stock unthaw! Dip the pipette tip into LB medium.

 

4. Extract HBV plasmid from 1.5 mL culture medium by High speed Plasmid Mini Kit (Geneaid, Taiwan) according to manufacturer’s procedure (Note 6).

Note 6: High speed Plasmid Mini Kit usually yield 5–10 μg of HBV plasmid dissolved in 50 uL water.

 

5. Check the identity of the extracted plasmid by SmaI and SacII digestion, separately. Follow the procedure provided by the manufacture. Digestion of the HBV plasmid with SmaI will result in two 4 Kb bands. Digestion with SacII will result in a 3.2 Kb and a 4.7 Kb band (Fig. 2).
6. Transfer the remaining 3mL culture medium into 1L LB medium. Incubate the medium with 250 rpm shaking at 37 ^oC for approximately 16 hours.
7. Harvest the cells by centrifuging the medium with 6000g for 15min at 4 ^oC (Note 7) and extract plasmid by using QIAGEN EndoFree^® Plasmid Maxi kit.

Note 7: If necessary, make a glycerol stock by acquiring 500 uL culture medium to 500μL of 50% glycerol in a 2 mL screw top tube and gently mix. Store in -80 ^oC.

8. Check DNA quality and concentration by NanoDrop (Note 8). A good quality of plasmid DNA should have A260/A280 ratio ≥ 1.8.

Note 8: 1L LB medium usually yields 800 μg HBV plasmid dissolved in 400 μL water (2μg/μL).

9. It is important that the purified plasmid DNA is of high quality and protein-, endotoxin-, DNase-, RNase-free to prevent adverse or toxic effects on the animal. To achieve this, we routinely use the Qiagen Endofree Kit (Qiagen, Cat. #: 12362).

 

Hydrodynamic Injection

1. Measure body weight of the mouse.
2. Prepare 10 μg of HBV plasmid DNA dissolved in a volume of PBS equivalent to 8% of the mouse body weight (Note 9). To assist in determining the amount of delivery solution for each individual mouse at the time of injection, it is advised to prepare a worksheet that has already calculated the volume of HBV plasmid needed for each injection and subtracted that volume from the total volume that is to be injected. This allows for the injection procedure to be more time efficient and less prone to error.

Weight of mouse (g)	10μg/mL pAAV/HBV 1.2 plasmid DNA concentration (ml)	A volume of PBS equivalent to 8% of the mouse body weight (ml)	Total volume (ml)
20	1	0.60	1.60
21	1	0.68	1.68
22	1	0.76	1.76
23	1	0.84	1.84
24	1	0.92	1.92

Note 9: Make 1x PBS by diluting 10x PBS with water. Sterilize the PBS by autoclave and filter with a 0.22 µm pore size hydrophilic PVDF membrane (Millex®-GS, Merck Millpore Ltd., USA) before use.

3. Dilate the tail vessels prior to injection by warming the mouse tail with a safe and effective heat source (e.g., heat lamp (120W bulb)) for 5-10 minutes (Note 10). This step facilitates tail vein visualization and ensures optimal injection. As the mouse tail warms up, the vein should dilate and become more visible. Keep the mouse warm before hydrodynamic injection (Fig 3).

Note 10: Do not overheat the mouse with the heat lamp. Excessive movement and/or perspiration are indicators of overheating.

4. Anesthetize the mouse using Imalgene (ketamine, 60mg/kg) and Rompun™ (xylazine, 12mg/kg) administered by intramuscular injection.
5. Secure the mouse with a restraint device before hydrodynamic injection.
6. While working under a light source, locate the dilated vein on the ventral side of the mouse tail, preferably near the distal end (tip) of the tail.
7. Swab the area with an alcohol pad and allow it air dry to further increase vein visibility and sterilize the site of injection.
8. Connect the needle to the syringe and fill with the entire injection solution, ensuring that there is no air bubble in the needle or syringe (Note 11).

Note 11: With the needle pointing up, finger tap the syringe a few times to move air bubbles to the needle and carefully eject the air until a small volume of solution is ejected.

9. Place the syringe needle nearly parallel to the tail with the bevel down (toward the tail). Insert the needle into the tail vein (Note 12). If the needle is inserted correctly, the vein should begin to be clear of blood (Note 13).

Note 12: Introduce the needle at the distal portion of the tail. This allows for better observation of the needle entering the vein. If subcutaneous hemorrhaging occurs, the needle can be moved further up (towards the proximal end) to find a new injection site.

Note 13: If the needle is positioned properly upon injection, clearing of the vein will be apparent, and there will be no local swelling or discoloration of the tail. If there is significant resistance, the needle may not be properly inserted into the tail vein. Improper needle insertion into tail tissue is characterized by discoloration and local swelling. When this occurs, remove the needle and reposition it correctly moving further proximal on the tail.

10. Dispense the complete volume of the solution into the mouse tail vein within 5–7 seconds at a constant rate (Note 14). A good injection is characterized by a constant resistance that does not increase during the procedure.

Note 14: In our experience, the delivering duration is critical. On the one hand, less than 5 seconds of delivering may increase death rate of the mouse. On the other hand, delivering duration longer than 8 seconds usually compromise the efficacy of HBV transfection.

11. Release the mouse from the restraint device.
12. Mouse usually tolerates the hydrodynamic injection well, but immediately after injection, it may remain immobile and manifest labored breathing that persists for ~5min. The observed apnea is probably due to a vasovagal response from the large, rapidly administered bolus of HBV DNA solution. Gentle massaging the chest of the mouse is sufficient to stimulate breathing and facilitate recovery (Note 15). The heart rate may slow or increase rapidly within the first minute post injection, however, this should normalize. The mouse should recover within 5 min of the injection. If the mouse appears to be seizing after the injection, this may be an indicator that either an air bubble or an impurity entered the circulation and the mouse may not survive. Careful monitoring of the mice post injection is necessary.

Note 15: Chest messaging decreases the rate of mouse death from roughly 30% to less than 10%. Gently push the chest of the mouse using the index finger at the rate of one time per second for 1 to 2 minutes or until spontaneous breath is recovered. Usually mouse will recover to spontaneous breathing after 1–2 minutes.

13. Stop the bleeding by applying the medical gauze to the injection site.
14. Collect serum on day 2, 7, 10, and weekly after hydrodynamic injection until the end of experiment (Note 16).

Note 16: There are many ways to collect blood from mice. We use facial vein technique described as follow. Cup the non-dominant hand (the left hand for most people) over the mouse, and scruff it firmly using the thumb and index finger. Locate the hairless freckle on the side of the jaw. Pick up the lancet with your free hand. Point the lancet at the far side of the mouse’s face, at the base of the far ear or at the base of the far side of the mouth. Prick the freckle with the lancet. Collect 4–7 drops of blood to a 1.5 mL eppendorf tube (the amount depends on frequency of bleeding). Release the mouse into its cage when you have obtained your sample. Bleeding should cease immediately.

15. Centrifuge the sample for 3 minutes at 16,000 g at room temperature (Note 17).

Note 17: Leaving the blood sample untreated longer than a couple of hours is not recommended.

16. Transfer the supernatant into a new eppendorf and repeat Step 14 to obtain serum. The serum is ready for analysis. If necessary, store at -20 ^o
17. Measure HBsAg and anti-HBs using an ABBOTT ARCHITECT HbsAg and anti-HBs kits (ARCHITECT I system) (Note 18) (Note 19).

Note 18: Specimens with an HBsAg value exceeding 250 IU/mL, are flagged with the code “>250.00 IU/mL”. Nevertheless, usually serum HBsAg will reach to highest level, which is several to 10 thousands IU/mL, between 2 to 7 days after hydrodynamic injection, and the value will drop gradually afterwards. We will make 1:40 dilution by adding 10 μL serum into 390 μL PBS during the first 2 weeks after hydrodynamic injection. After that, the dilution factor will become 1:20.

Note 19: In our experience, mice with serum HBsAg lower than 600 IU/mL at 2 days after HDI is a sign of unsuccessful transfection and will not be included for further follow-up.

Conclusion and future prospects

As described above, hydrodynamic injection provides an effective approach to deliver DNA, RNA, protein and virus into hepatocytes. Besides the applications in the studies of liver diseases, HDI by HBV DNA in either SPF or GF mice provide a convenient and invaluable experimental tool for studying immunology of hepatitis B and also the role of the gut microbiota. Such research outcomes will continue to advance to benefit both basic and clinical research of hepatitis B.

 

Acknowledgement

Patient Derived Tumor, Gut Microbiota Transplantation and Gene Modification Service at the National Core Facility for Biopharmaceuticals (MOST 107-2319-B-492-001), National Laboratory Animal Center, National Applied Research Laboratories, Taiwan. This work was supported by MOST grant 107-2321-B-002 -002 –, 107-2811-B-002 -582 – and 107-2321-B-002 -004 -for the Advancement of science and technology to RHS.