HBV Research Protocols

HBV Ribonuclease H assay resolved by denaturing PAGE

SENIOR AUTHOR
MAIN AUTHOR

Author's Information

Cassandra Kukla, Tiffany Edwards and John Tavis. Saint Louis University, St. Louis, USA

Saint Louis University

Introduction

- This assay characterizes the products of HBV RNase H activity on a DNA:RNA heteroduplex - Products are resolved by denaturing PAGE to assess specificity of cleavage and effects of inhibitory compounds on the enzyme

Materials and Reagents

HBV Ribonuclease H: This protocol requires purified recombinant HBV RNaseH. Purification of the enzyme is a lengthy procedure and the protocol is undergoing refinement. Please contact John Tavis (john.tavis@health.slu.edu) for the current protocol and RNaseH expression plasmid. Substrate: Any RNA of 200-300 nt annealed to a complementary oligo that binds ~30% from one end will work. We use an in vitro transcribed RNA called “DRF+” together with complementary and non-complementary DNA oligos. These sequences are: DRF+ = GAACAAAAGCUUGCAUGCCUGCAGGUCGACUCUAGAGGAUCCCCACUUUGUCCCGAGCAAAUAUAAUCCUGCUGACGGCCCAUCCAGGCACAGACCGCCUGAUUGGACGGCUUUUCCAUACACCCCUCUCUCGAAAGCAAUAUAUAUUCCACAUAGGCUAUGUGGAACUUAAGAAUUACACCCCUCUCCUUCGGAGCUGCUUGCCAAGGUAUCUUUACGUCUACAUUGCUGUUGUCGUGUGUGACUGUGGGUACCGAGCUCGAAUU (1 ug/uL) Complementary DNA oligo = 5’ GTCCGTACGTTCGAAAACAAG (1 ug/uL) Non-complementary DNA oligo (negative control) = 5’ CAGGCATGCAAGCTTTTGTTC (1 ug/uL) Reagents: -Nuclease free H2O, RNaseOUT (Thermo Fisher) -10x RNase H Buffer (1 M NaCl, 500 mM HEPES pH 8.0) -50 mM MgCl2, DMSO -SYBR Gold (Thermo Fisher) -9% sequencing acrylamide (8M Urea, 1x TBE, 6% acrylamide [19:1 acrylamide: bis-acrylamide]) -10% Ammonium Persulfate -Tetramethylethylenediamine -Sequencing loading buffer (98% formamide, 10 mM EDTA, 0.025% bromophenol blue, 0.025% xylene cyanol)

Experimental Procedures

RNaseH reactions: Per reaction in an RNaseH free tube or well of a plate: Combine 3.5 uL nuclease free H2O, 2 uL 10x RNaseH Buffer, and 0.5 uL RNaseOUT -Then add to each reaction (in the following order): 3 uL DNA oligo, 2 uL test compound (diluted to 10x desired concentration) or water if an inhibitor is not being tested, 6 uL HBV RNaseH (adjust concentration as needed to balance activity), and 1 uL substrate RNA. - Incubate reactions for 90 minutes at 37oC - Stop reactions by adding 80 uL sequencing loading buffer Electrophoresis: - Pour a denaturing 9% Urea PAGE/TBE gel. - Boil samples for 5 minutes. -Load 50 uL sample per lane (remaining sample can be stored at -80C). - Run the gel until the bromophenol blue dye front is near the bottom. Rinse gel in water to remove urea 2-3x for 15 minutes. -Stain gel with SYBR gold: Rock gel at RT in 1:1000 dilution of SYBR Gold in 1x TBE for 20 minutes - Image on a high-sensitivity imaging system such as a GE Typhoon or equivalent instrument. Interpretation: RNaseH activity will be evident as cleavage of the RNA at the site where the DNA oligonucleotide bound. This results in 3 bands: uncleaved substrate, the larger product, and a smaller product Notes: - Include a reaction lacking a DNA oligo and one containing the incorrect polarity DNA oligo as specificity controls. No RNA:DNA heteroduplex will form under those conditions, so any RNA degradation under those conditions will be background. - Adjust the molar ratio of DNA to RNA as needed to get adequate cleavage. Most RNAs have substantial secondary structure, and a high ratio of DNA:RNA is needed for the DNA to bind to RNA sites in strong secondary structures.

References

Cai, C.W., Lomonosova, E., Moran, E.A., Cheng, X. Patel, K.B., Bailly, F., Cotelle, P., Meyers, M.J., and Tavis, J.E. (2014). Hepatitis B Virus replication is blocked by a 2-hydroxyisoquinoline-1,3(2H,4H)-dione (HID) inhibitor of the viral ribonuclease H activity. Antiviral Res. 108:48-55. https://www.sciencedirect.com/science/article/pii/S0166354214001363?via%3Dihub Villa, J.A., Pike, D.P., Patel, K.B., Lomonosova, E., Lu, G., Abdulqader, R., and Tavis, J.E. (2016). Purification and enzymatic characterization of the hepatitis B virus ribonuclease H, a new target for antiviral inhibitors. Antiviral Research, 132:186-195. https://www.sciencedirect.com/science/article/pii/S0166354216301553?via%3Dihub Edwards, T.C., Mani, N., Dorsey, B., Kakarla, R., Rijnbrand, R., Sofia, M.J., and Tavis, J.E. (2019). Inhibition of HBV replication by N-hydroxyisoquinolinedione and N-hydroxypyridinedione ribonuclease H inhibitors. Antiviral Res. 164:70-80. https://www.sciencedirect.com/science/article/pii/S0166354218306405?via%3Dihub  

Leave a Reply

We are glad you have chosen to leave a comment. Please keep in mind that comments are moderated according to our commenting policy.

Recently Published Protocols