HBV Research Protocols

HBV Ribonuclease H assay resolved by denaturing PAGE

SENIOR AUTHOR
MAIN AUTHOR

Author's Information

Cassandra Kukla, Tiffany Edwards and John Tavis. Saint Louis University, St. Louis, USA

Saint Louis University

Introduction

  • This assay characterizes the products of HBV RNase H activity on a DNA:RNA heteroduplex.
  • Products are resolved by denaturing PAGE to assess specificity of cleavage and effects of inhibitory compounds on the enzyme

Materials and Reagents

  • HBV Ribonuclease H: This protocol requires purified recombinant HBV RNaseH. Purification of the enzyme is a lengthy procedure and the protocol is undergoing refinement. Please contact John Tavis (john.tavis@health.slu.edu) for the current protocol and RNaseH expression plasmid.]
  • Substrate: Any RNA of 200-300 nt annealed to a complementary oligo that binds ~30% from one end will work. We use an in vitro transcribed RNA called “DRF+” together with complementary and non-complementary DNA oligos. These sequences are: DRF+ = GAACAAAAGCUUGCAUGCCUGCAGGUCGACUCUAGAGGAUCCCCACUUUGUCCCGAGCAAAUAUAAUCCUGCUGACGGCCCAUCCAGGCACAGACCGCCUGAUUGGACGGCUUUUCCAUACACCCCUCUCUCGAAAGCAAUAUAUAUUCCACAUAGGCUAUGUGGAACUUAAGAAUUACACCCCUCUCCUUCGGAGCUGCUUGCCAAGGUAUCUUUACGUCUACAUUGCUGUUGUCGUGUGUGACUGUGGGUACCGAGCUCGAAUU (1 ug/uL) Complementary DNA oligo = 5’ GTCCGTACGTTCGAAAACAAG (1 ug/uL) Non-complementary DNA oligo (negative control) = 5’ CAGGCATGCAAGCTTTTGTTC (1 ug/uL)
  • Reagents
    • -Nuclease free H2O, RNaseOUT (Thermo Fisher)
    • -10x RNase H Buffer (1 M NaCl, 500 mM HEPES pH 8.0)
    • -50 mM MgCl2, DMSO
    • -SYBR Gold (Thermo Fisher)
    • -9% sequencing acrylamide (8M Urea, 1x TBE, 6% acrylamide [19:1 acrylamide: bis-acrylamide])
    • -10% Ammonium Persulfate
    • -Tetramethylethylenediamine
    • -Sequencing loading buffer (98% formamide, 10 mM EDTA, 0.025% bromophenol blue, 0.025% xylene cyanol)

Experimental Procedures

RNaseH reactions: Per reaction in an RNaseH free tube or well of a plate:
  • -Combine 3.5 uL nuclease free H2O, 2 uL 10x RNaseH Buffer, and 0.5 uL RNaseOUT
  • -Then add to each reaction (in the following order): 3 uL DNA oligo, 2 uL test compound (diluted to 10x desired concentration) or water if an inhibitor is not being tested, 6 uL HBV RNaseH (adjust concentration as needed to balance activity), and 1 uL substrate RNA.
  • - Incubate reactions for 90 minutes at 37oC
  • - Stop reactions by adding 80 uL sequencing loading buffer
Electrophoresis:
  • - Pour a denaturing 9% Urea PAGE/TBE gel.
  • - Boil samples for 5 minutes.
  • -Load 50 uL sample per lane (remaining sample can be stored at -80C).
  • - Run the gel until the bromophenol blue dye front is near the bottom. Rinse gel in water to remove urea 2-3x for 15 minutes.
  • -Stain gel with SYBR gold: Rock gel at RT in 1:1000 dilution of SYBR Gold in 1x TBE for 20 minutes
  • - Image on a high-sensitivity imaging system such as a GE Typhoon or equivalent instrument.
Interpretation: RNaseH activity will be evident as cleavage of the RNA at the site where the DNA oligonucleotide bound. This results in 3 bands: uncleaved substrate, the larger product, and a smaller product

Notes:
  • - Include a reaction lacking a DNA oligo and one containing the incorrect polarity DNA oligo as specificity controls. No RNA:DNA heteroduplex will form under those conditions, so any RNA degradation under those conditions will be background.
  • - Adjust the molar ratio of DNA to RNA as needed to get adequate cleavage. Most RNAs have substantial secondary structure, and a high ratio of DNA:RNA is needed for the DNA to bind to RNA sites in strong secondary structures.

References

  • Cai, C.W., Lomonosova, E., Moran, E.A., Cheng, X. Patel, K.B., Bailly, F., Cotelle, P., Meyers, M.J., and Tavis, J.E. (2014). Hepatitis B Virus replication is blocked by a 2-hydroxyisoquinoline-1,3(2H,4H)-dione (HID) inhibitor of the viral ribonuclease H activity. Antiviral Res. 108:48-55. https://www.sciencedirect.com/science/article/pii/S0166354214001363?via%3Dihub
  • Villa, J.A., Pike, D.P., Patel, K.B., Lomonosova, E., Lu, G., Abdulqader, R., and Tavis, J.E. (2016). Purification and enzymatic characterization of the hepatitis B virus ribonuclease H, a new target for antiviral inhibitors. Antiviral Research, 132:186-195. https://www.sciencedirect.com/science/article/pii/S0166354216301553?via%3Dihub
  • Edwards, T.C., Mani, N., Dorsey, B., Kakarla, R., Rijnbrand, R., Sofia, M.J., and Tavis, J.E. (2019). Inhibition of HBV replication by N-hydroxyisoquinolinedione and N-hydroxypyridinedione ribonuclease H inhibitors. Antiviral Res. 164:70-80. https://www.sciencedirect.com/science/article/pii/S0166354218306405?via%3Dihub

Leave a Reply

We are glad you have chosen to leave a comment. Please keep in mind that comments are moderated according to our commenting policy.

Recently Published Protocols